日本語 Japanese | 英語 English

Specimens | TNS:F:43821 | Detail

Back

Dataset

DNA barcode database of Japanese mushrooms

Images

Specimen image 43821 1
Specimen image 43821 2
Specimen image 43821 3
Specimen image 43821 4
Specimen image 43821 5
Specimen image 43821 6

Sequences

Region nameITS
DDBJ Accession No.
BOLD Accession No.

TNS:F:43821:ITS>
TTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACCAAATGTGTTAGGCATGCGAGGGCTG
TCGCTGACCTCGAGGTCGTGCACGCCGGAGCGTGTCCTCTCACATAACGCAATCCATCTCACCC
TTTGTGCACCACCGCGTGGGCCCCCTTTGGGGGGCTCGCGTCTTCACACAAAACCCCCCCTTTA
AAAGTGTAGAGTGACCTCATTTATGAAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTC
GCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATC
GAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGA
ATACCTCAACCTCCTTGGTTTCTTCTGGAGACCGAAGGAGGCTTGGACTTTGGAGGCCCTTGCT
GGCGTCTCTGCCAGCTCCTCTCAAATGAATTAGTGGGGTCCCCTTTGCCGATCCTTGACATGTG
ATAAGATGCTTCCGTGTCTCGGTTTCTGGCTCTGTTGCTTTTGGGACCCGCTTCTAATCGTCTA
GACCTTGCGTCAAGACAATGTTCAAGCCACGTCTCCCTTGTCGGGAAATGTCCTTGACCTCATG
AACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAG

Detail

Institution CodeTNS
Collection CodeF
Catalog Number43821
Record Number
KingdomFungi
PhylumBasidiomycota
ClassAgaricomycetes
OrderRussulales
FamilyRussulaceae
Subfamily
Tribe
GenusLactarius
Subgenus
Specific Epithetsp.
Taxon Rank
Infraspecific Epithet
Scientific NameLactarius sp.
Scientific Name Authorship
Other Names
Subspecies Range
Identified ByK. Hosaka
Date Identified
Taxon Remarks
CountryJapan
Higher GeographyIbaraki, Tsukuba, Amakubo, Tsukuba Botanical Garden: Evergreen Broad-leaved Forest section
Continent
Water Body
Island Group
Island
State ProvinceIbaraki
County
MunicipalityTsukuba
LocalityAmakubo
Locality DetailTsukuba Botanical Garden: Evergreen Broad-leaved Forest section
Elevation
Depth
Coodinates
Geodetic Datum
Verbatim Coordinates
Field Number
Georeference Remarks
Sex
Start Collecting Date2011-11-17
End Collecting Date
Recorded ByK. Hosaka
Type Status
Sampling Protocol
Life StageFruit bodies
Ecological Information
Preparationsdried; tissues preserved in DMSO buffer
Tissue Institution Code
Tissue Collection Code
Tissue Catalog NumberA6125
Remarks

Back

Ruga-specimen system created by Utsugi Jinbo (National Museum of Nature and Science)