日本語 Japanese | 英語 English

Specimens | NSMT:A:15325 | Detail

Back

Dataset

DNA barcode database of Japanese birds

Images

Specimen image 15325 1
Specimen image 15325 2
Specimen image 15325 3

Sequences

Region nameCOI
DDBJ Accession No.
BOLD Accession No.

NSMT:A:15325:COI>
ATAGTGGGTACCGCCCTTAGCCTCCTCATCCGAGCAGAACTGGGCCAACCAGGCGCCCTACTAG
GAGACGACCAAGTCTACAACGTAGTCGTCACGGCCCATGCTTTTGTGATAATCTTCTTCATAGT
TATACCAATCATGATTGGAGGATTCGGGAACTGACTAGTCCCTCTAATGATTGGGGCCCCAGAC
ATAGCATTCCCCCGAATAAACAACATGAGCTTTTGACTACTACCACCATCCTTCCTACTACTTC
TAGCCTCTTCTACAGTAGAAGCAGGGGTAGGAACAGGCTGAACTGTATACCCACCACTCGCTGG
TAATCTAGCCCACGCTGGAGCATCAGTAGACCTAGCCATCTTCTCCCTACACCTAGCTGGTATT
TCCTCTATTCTAGGTGCCATCAACTTCATTACAACAGCAATCAACATAAAACCCCCTGCCCTCT
CACAATATCAAACCCCCCTATTTGTTTGATCAGTTCTAATCACTGCAGTCCTACTCCTCCTATC
CCTTCCAGTCCTCGCCGCCGGCATCACAATGCTACTCACTGACCGCAACCTAAACACCACCTTC
TTCGACCCCGCAGGAGGAGGGGACCCAGTACTTTACCAACACTTATTCTGATTCTTTGGTCA

Detail

Institution CodeNSMT
Collection CodeA
Catalog Number15325
Record Number
KingdomAnimalia
PhylumChordata
ClassAves
OrderPasseriformes
FamilyEmberizidae
Subfamily
Tribe
GenusEmberiza
Subgenus
Specific Epithetyessoensis
Taxon Rank
Infraspecific Epithet
Scientific NameEmberiza yessoensis
Scientific Name Authorship(Swinhoe, 1874)
Other Names
Subspecies Range
Identified ByIbaraki,Shinjuku-ku
Date Identified
Taxon Remarks
CountryJapan
Higher Geography
Continent
Water Body
Island Group
Island
State ProvinceIbaraki
County
MunicipalityShinjuku-ku
Locality
Locality Detail
Elevation
Depth
Coodinates35.9070 N, 35.9070 E
Geodetic Datum
Verbatim Coordinates
Field Number
Georeference Remarks
Sexfemale
Start Collecting Date2005-05-08
End Collecting Date
Recorded By
Type Status
Sampling Protocol
Life Stageadult
Ecological Information
Preparationsskin
Tissue Institution CodeNSMT
Tissue Collection CodeNSMT-DNA4128
Tissue Catalog Number
Remarks

Back

Ruga-specimen system created by Utsugi Jinbo (National Museum of Nature and Science)