日本語 Japanese | 英語 English

Specimens | NSMT:A:15089 | Detail

Back

Dataset

DNA barcode database of Japanese birds

Images

Specimen image 15089 1
Specimen image 15089 2
Specimen image 15089 3

Sequences

Region nameCOI
DDBJ Accession No.
BOLD Accession No.

NSMT:A:15089:COI>
CGGCACTCTTTACCTAATCTTCGGCGCATGAGCTGGAATAGTGGGTACAGCCCTAAGTCTCCTC
ATTCGAGCAGAGTTAGGCCAACCAGGTGCCCTACTAGGCGACGACCAAATCTACAACGTGGTTG
TTACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATTATGATTGGAGGGTTCGG
AAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAACAACATA
AGCTTTTGACTCCTCCCCCCATCCTTCCTTCTCCTCCTAGCCTCCTCTACAGTAGAAGCTGGAG
CAGGAACAGGTTGAACTGTCTATCCTCCCCTTGCCGGTAATCTAGCACACGCAGGGGCTTCAGT
AGACTTAGCCATCTTCTCCCTGCATCTAGCAGGAATCTCCTCAATCCTAGGAGCCATCAACTTC
ATCACAACAGCAATCAACATAAAACCACCTGCCCTCTCACAGTACCAAACCCCTCTATTCGTCT
GATCAGTCCTAATCACTGCAGTGCTACTCCTACTATCCCTCCCAGTCCTTGCCGCTGGCATCAC
TATACTCCTCACCGACCGCAACCTAAATACAACCTTCTTTGACCCAGCAGGGGGAGGAGACCCA
GTACTGTACCAGCACCTCTTCTGATTCTTTGGTCACCCCGAGGTCTATATTCTCATCCTCC

Detail

Institution CodeNSMT
Collection CodeA
Catalog Number15089
Record Number
KingdomAnimalia
PhylumChordata
ClassAves
OrderPasseriformes
FamilyMuscicapidae
Subfamily
Tribe
GenusTurdus
Subgenus
Specific Epithetchrysolaus
Taxon Rank
Infraspecific Epithet
Scientific NameTurdus chrysolaus
Scientific Name AuthorshipTemminck, 1832
Other Names
Subspecies Range
Identified ByTokyo,Oosghima-cho
Date Identified
Taxon Remarks
CountryJapan
Higher Geography
Continent
Water Body
Island GroupIzu Islands
IslandOshima Island
State ProvinceTokyo
County
MunicipalityOosghima-cho
Locality
Locality Detail
Elevation
Depth
Coodinates34.7440 N, 34.7440 E
Geodetic Datum
Verbatim Coordinates
Field Number
Georeference Remarks
Sexmale
Start Collecting Date2001-01-08
End Collecting Date
Recorded By
Type Status
Sampling Protocol
Life Stage
Ecological Information
Preparationsskin
Tissue Institution CodeNSMT
Tissue Collection CodeNSMT-DNA1823
Tissue Catalog Number
Remarks

Back

Ruga-specimen system created by Utsugi Jinbo (National Museum of Nature and Science)