日本語 Japanese | 英語 English

Specimens | KUZ:KUZ:R51130 | Detail

Back

Dataset

DNA barcode vouchers of Systematic Zoology Lab, Kyoto University

Images

Specimen image R51130 1
Specimen image R51130 2

Sequences

Region namecytochromeb
DDBJ Accession No.
BOLD Accession No.

KUZ:KUZ:R51130:cytochromeb>
CTTCGGCTCGCTACTGGGGGTGTGCCTTATTACACAAGTATTAACAGGCCTATTTCTAGCCATG
CACTATACAGCAGATATTTCCTCTGCCTTCTCCTCCGTCGCCCATATCTGTCGAGACGTACAAT
ACGGCTGACTTATCCGAAACCTACACGCCAATGGCGCATCCATGTTCTTCATTTGCATTTACCT
CCACATTGGACGGGGCCTTTACTACGGCTCATACATATATAAAGAAACCTGAAATATTGGGGTA
GTTCTCCTACTTCTAGTAATGGCAACAGCATTTGTGGGATACGTTCTTCCATGAGGACAAATAT
CCTTCTGAGGCGCAACCGTAATTACAAACCTATTATCAGCAATCCCGTACATTGGCACAAGCCT
AGTAGAGTGAATCTGGGGGGGATTCTCCGTAGATAACGCAACTCTCACCCGATTTTTCACATTC
CACTTCCTCCTACCTTTCGCCGTCATGGGAGCTTCAATAATCCACCTAATGTTCCTCCACGAAA
CAGGATCAAACAACCCAACTGGACTAAACTCAAACACGGACAAAATCCCATTCCACCCGTATTA
CACGTACAAAGACCTCCTAGGACTCACTATTATATTATTCTTCCTCCTACTCCTCGCCCTATTC
GCACCAAATCTTCTAGGTGACCCAGAAAATTTTACCCCAGCAAACCCCCTAGTAACCCCTCCCC
ACATCAAACCAGAATGATACTTCCTGTTCGCATACGCCATTCTCCGCTCCATTCCAAATAAGCT
TGGGGGCGTCCTAGCCCTCTTATTCTCAATCCTAGTACTCCTAACAATCCCACTACTACACACA
TCTAAACAACGAAGCAACACCTTCCGCCCAATCTCACAAATCATATTCTGAACACTTATCTCAA
ACATCATTATTCTC

Region namemitochondrialLSUrRNA
DDBJ Accession No.
BOLD Accession No.

KUZ:KUZ:R51130:mitochondrialLSUrRNA>
TGTCTTCTAAATAAAGACCAGTATGAACGGCTAAATGAGGACAAACCTGTCTCTTGCAACCAAT
CAGTGAAACTGATCTCCCGGTCCAAAAGCCGGGATAACCCCATAAGACGAGAAGACCCTGTGGA
GCTTGAAACAAGCTACTATGCACCACACAAGCTGCAACTAGTAGGCAGTTTTAAGTTGGGGCGA
CTTCGGAACCAAAAAAAACTTCCGAGCACAGAACCACCCACTCTTACCAAGACTAACAAGTCAA
AGTCAAAAACGACCCAGTAACACTGATCAACGAACCAAGTTACCCCAGGGATAACAGCGCCATC
TTCTTCAAGAGTTCATATCGACAAGAAGGTTTACGACCTCGATGTTGGATCAGGACACCCCAAT
GGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAATAGT

Region namemitochondrialSSUrRNA
DDBJ Accession No.
BOLD Accession No.

KUZ:KUZ:R51130:mitochondrialSSUrRNA>
GCTCAGCCATAAACTATGGTAGTGTAATCACAATACTACCCGCCAGAGAACTACAAGTGAAAAA
CTTAAAACTCCAAGGACTTGGCGGTGCTCCACATCAACCTAGAGGAGCCTGTCCTATAATCGAT
AATCCACGTTCCACCCTACCACCTTTTGCCCTCAGCCTATATACCGCCGTCGTCAGCCTACCTT
CTGAAAGAAGCACAGTAAGCAAAACAGTTATTAACTAGCACGTCAGGTCAAGGTGTAGCACATA
AGGTGGAAGAGATGGGCTACATTTTCTGCCACAGAAAACACGAACAGCCTAATGAAACTTAGAC
CAAAAGGCGGATTTAGCAGTAAGACAAGCAAGAAACCCTGTCTTAAACCCGCTCTGGAGCGCGC

Detail

Institution CodeKUZ
Collection CodeKUZ
Catalog NumberR51130
Record Number
KingdomAnimalia
PhylumChordata
ClassReptilia
OrderSquamata
FamilyScincidae
SubfamilyScincinae
Tribe
GenusPlestiodon
Subgenus
Specific Epithetfinitimus
Taxon Rank
Infraspecific Epithet
Scientific NamePlestiodon finitimus
Scientific Name AuthorshipOkamoto et Hikida, 2012
Other Names
Subspecies Range
Identified ByT. Okamoto
Date Identified2012/08/23
Taxon Remarks採集時の同定:ニホントカゲ Eumeces japonicus
CountryJapan
Higher GeographyShimobe Road Station, Shimobe, Yamanashi Pref.
Continent
Water Body
Island Group
Island
State ProvinceYamanashi
County
MunicipalityShimobe Town
Locality
Locality DetailShimobe Road Station
Elevation
Depth
Coodinates35.4692 N, 35.4692 E
Geodetic DatumWGS84
Verbatim Coordinates
Field Number
Georeference Remarks
Sexmale
Start Collecting Date2001-05-06
End Collecting Date2001-05-06
Recorded ByT. Okamoto
Type Status
Sampling Protocol
Life Stage
Ecological Information
PreparationsFixed in Formalin, preserved in 70% ethanol
Tissue Institution Code
Tissue Collection Code
Tissue Catalog Number
RemarksOkamoto et al. (2006, Zool. Sci., 23:419-425);Okamoto & Hikida (2009, J. Zool. Syst. Evol. Res., 47:181-188)

Back

Ruga-specimen system created by Utsugi Jinbo (National Museum of Nature and Science)