日本語 Japanese | 英語 English

Specimens | KUZ:KUZ:R36495 | Detail

Back

Dataset

DNA barcode vouchers of Systematic Zoology Lab, Kyoto University

Images

Specimen image R36495 1
Specimen image R36495 2

Sequences

Region namecytochromeb
DDBJ Accession No.
BOLD Accession No.

KUZ:KUZ:R36495:cytochromeb>
TTTTGGCTCATTATTAGGAGTATGCCTTATCGCACAAGTAGTAACAGGCCTATTCCTAGCCATG
CACTATACAGCGGACATTTCCTCTGCCTTCTCATCCGTCGCCCACATTTGTCGAGACGTACAAT
ACGGCTGACTCATCCGAAACTTACACGCCAATGGAGCATCCATATTTTTCATTTGCATCTACCT
TCACATCGGACGGGGCCTTTATTACGGCTCATACATGTTTAAAGAGACCTGAAACATCGGAGTA
ATCCTCCTACTTCTCGTAATAGCAACAGCATTCGTAGGATATGTCCTACCATGAGGACAAATAT
CCTTTTGAGGCGCAACCGTAATTACAAACCTCTTATCAGCAATTCCCTACATTGGCACAAGCCT
CGTGGAGTGAATCTGGGGTGGGTTCTCCGTAGACAACGCAACCCTCACCCGATTTTTCACATTC
CACTTCCTACTCCCCTTCGCTATCATAGGGGCCTCAATAATTCACCTACTATTCCTCCACGAAA
CAGGGTCAAACAACCCAACAGGACTAAACTCAAACACAGATAAAGTCCCATTCCACCCGTACTA
CACATACAAAGACCTCTTAGGGCTCGTCATCATACTACTTTTTCTCCTACTCCTCGCCCTATTT
GCACCAAACCTTTTAGGGGACCCAGAAAACTTCACTCCAGCAAACCCCCTAGTAACCCCACCAC
ACATCAAACCAGAGTGGTACTTTCTATTCGCATACGCCATCCTCCGCTCTATTCCAAATAAACT
TGGAGGCGTCCTAGCCCTATTACTCTCAATCCTAGTACTATTAGCAATCCCACTACTACACACA
GCTAAACAACGAAGCAACATCTTCCGCCCAATCTCACAGGCTATATTCTGAACACTAGTCTCAA
ATATTATTATTCTC

Region namemitochondrialLSUrRNA
DDBJ Accession No.
BOLD Accession No.

KUZ:KUZ:R36495:mitochondrialLSUrRNA>
TGTCTTCTAAATAAAGACCAGTATGAATGGCTAAATGAGGACAAACCTGTCTCTTGCAACTAAT
CAGTGAAACTGATCTCCCGGTCCAAAAGCCGGGATAAACCCATAAGACGAGAAGACCCTGTGGA
GCTTTAAACAAACTACCATGCACCCACCAACACTGCGACTAGTAGGGAGTTTTAAGTTGGGGCG
ACTTCGGAACTAAAAAAAACTTCCGAGCATAGAACCACCCGTTCTTACCAAGACCAACAAGTCA
AAGTCAAAAAATGACCCAGTAACACTGATCAACGAACCAAGTTACCCCAGGGATAACAGCGCCA
TCTTCTTCAAGAGTTCATATCGACAAGAAGGTTTACGACCTCGATGTTGGATCAGGACACCCCA
ATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAATAGT

Region namemitochondrialSSUrRNA
DDBJ Accession No.
BOLD Accession No.

KUZ:KUZ:R36495:mitochondrialSSUrRNA>
GCTTAGCCATAAACCAAGGTAGTATACATACAGCACTACCCGCCAGAGAACTACAAGTGAAAAA
CTCAAAACTCCAAGGACTTGGCGGTGCTCCACATCAACCTAGAGGAGCCTGTCCTATAATCGAT
AATCCACGTTTTACCCTACCACCTTTCGCCCTCAGCCTATATACCGCCGTCGTTCAGCCTACCC
TATGAAAGAAGTAAAGTAAGCAAAATAGTCACTAACTAGTACGTCAGGTCAAGGTGTAGCACAT
AAGGTGGAAGAGATGGGCTACATTCTCTACCATAGAGAACACGAACAGCTTAATGAAACTTAGG
CTAAAAGGCGGATTTAGAAGTAAGACAAACAAGAAACCCTGTCTTAAACCCGCTCTGGAGCGCG
C

Detail

Institution CodeKUZ
Collection CodeKUZ
Catalog NumberR36495
Record Number
KingdomAnimalia
PhylumChordata
ClassReptilia
OrderSquamata
FamilyScincidae
SubfamilyScincinae
Tribe
GenusPlestiodon
Subgenus
Specific Epithetlatiscutatus
Taxon Rank
Infraspecific Epithet
Scientific NamePlestiodon latiscutatus
Scientific Name AuthorshipHallowell, 1861
Other Names
Subspecies Range
Identified By
Date Identified2005
Taxon Remarks採集時の同定:オカダトカゲ Eumeces okadae
CountryJapan
Higher GeographyAko, Miyakejima Is., Izu Gr., Tokyo Metro.
Continent
Water Body
Island GroupIzu Group
IslandMiyakejima Island
State ProvinceTokyo
County
MunicipalityMiyake Village
LocalityAko
Locality Detail
Elevation
Depth
Coodinates
Geodetic Datum
Verbatim Coordinates
Field Number
Georeference Remarks
Sex
Start Collecting Date1996-04-25
End Collecting Date1996-04-25
Recorded By
Type Status
Sampling Protocol
Life Stage
Ecological Information
PreparationsFixed in Formalin, preserved in 70% ethanol
Tissue Institution Code
Tissue Collection Code
Tissue Catalog Number
RemarksOkamoto et al. (2006, Zool. Sci., 23:419-425)

Back

Ruga-specimen system created by Utsugi Jinbo (National Museum of Nature and Science)