日本語 Japanese | 英語 English

Specimens | FFPRI:TWT:23971 | Detail

Back

Dataset

DNA barcode database of Japanese woody plant

Images

Specimen image 23971

Sequences

Region namerbcL
DDBJ Accession No.
BOLD Accession No.

FFPRI:TWT:23971:rbcL>
TACAAATTGACTTATTATACTCCTGACTATATCACCAAAGATACTGATATCTTGGCAGCATTCC
GAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCGGAATCTTC
TACAGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGA
TGCTACGACATCGAGCCTGTTGCTGGAGAGGAGAACCAATATATTTGTTATGTAGCTTACCCTT
TAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGG
GTTCAAAGCGCTACGCGCTCTACGTCTGGAGGATCTGCGAATCCCTACCTCTTATGTTAAAACT
TTCCAAGGCCCGCCTCATGGCATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCC
TATTGGGCTGTACTATTAAACCAAAATTGGGATTATCTGCTAAGAACTACGGTAGAGCGGTTTA
TGAATGTCTCCGTGGTGGACTGGATTTTACCAAGGATGATGAAAACGTGAACTCCCAGCCATTT
ATGCGTTGGAGAGACCGTTTCCTATTTTGTGCCGAAGCAATTTATAAATCACAGGCCGAAAC

Region nametrnH-psbA
DDBJ Accession No.
BOLD Accession No.

FFPRI:TWT:23971:trnH-psbA>
AAAAAAAAAAACCATATGGTAGAAATTGAATTTCTTTTTTTGTTATTTTTCATTTTTTAATTGA
GTTTTTTAATTGAGTAGTTCTTACTTTTCTTGATACTAAGATATACTAAAATACAGATATTGGG
CATGCAAGACCAATCCTTTATAAAAAAGTAGCTTTAGTTTCATAATTTCCATAATTTATGAAAA
AAGTCAAGTCAAAAAATTTCGAGGAACATATAACATATATAAATTCATAAATTATATATTTTAT
ACAGAACAAAAGTTTGATACTCAATAATGAATAAACCTATATTCATTTTTATTTTAGTTAAAAT
AAATAAAAAAAAAAAAGAGCAGATTCTGCGAGTAAAAACTACTAAAACTAAATGAAGGAACAAT
ACCCGTCCTCTTGATAGAACAAGAAATTGGGTATTACTCCTTCACCTTCAATCACTCGGATACA
CTAAGACGGAAATCTTATCCATTTGTCGCTGGAGCTTCGACAGCACCTAGGTCTAAAGGGAAGT
TGTGAGCA

Detail

Institution CodeFFPRI
Collection CodeTWT
Catalog Number23971
Record Number
KingdomPlantae
PhylumMagnoliophyta
ClassMagnoliopsida
OrderRanunculales
FamilyLardizabalaceae
Subfamily
Tribe
GenusAkebia
Subgenus
Specific Epithetquinata
Taxon Rank
Infraspecific Epithet
Scientific NameAkebia quinata
Scientific Name Authorship
Other Names
Subspecies Range
Identified By
Date Identified2008//
Taxon Remarks
CountryJapan
Higher Geography
Continent
Water Body
Island Group
Island
State ProvinceSaga
CountyNishiMatuura
MunicipalityArita
Locality
Locality Detail
Elevation510.0 m
Depth510.0 m
Coodinates33.2186 N, 33.2186 E
Geodetic Datum
Verbatim Coordinates
Field Number
Georeference Remarks
Sex
Start Collecting Date2008-05-02
End Collecting Date
Recorded ByS. Noshiro, T. Fujii, K. Kuroda, T. Tanaka, M. Hasegawa, Y. Sasaki, S. Suzuki, M. Miura, S. Wakui, M Kumashiro
Type Status
Sampling Protocol
Life Stage
Ecological Information
Preparations
Tissue Institution Code
Tissue Collection Code
Tissue Catalog Number
Remarks

Back

Ruga-specimen system created by Utsugi Jinbo (National Museum of Nature and Science)